Theoretical experimental design of a novel Streptococcus aureus vesicle vaccine manufactured using a Streptomyces coelicolor cell chassis
Experimental Design
¹Biochemical Engineering ‘25, ²Biomedical Engineering ‘24, ³Biochemical Engineering '24, ⁴Chemical Engineering '24
- All authors contributed to the writing of this article. JC managed revisions during the editorial process.
Introduction
The resistome is the totality of the ancient genetic base of antibiotic-resistant genes among bacterial species. In the past, the resistome was wholly the subject of the natural world and the antibiotics that developed within it. However, ever since the use and misuse of antibiotics by humans began, the balance between the resistome and antibiotics has turned into a race between the emergence of highly antibiotic-resistant “superbugs” and the development of novel antibiotic compounds and antibiotic techniques [1]. Among those superbugs that have become of human concern in recent years, Methicillin-resistant S. aureus (MRSA) is one of the most important.
This paper aims to outline a possible novel vesicle vaccine that is effective against MRSA, and additionally, the process by which the vaccine might be experimentally created. Vesicle vaccines function by presenting antigens on the surface of extracellular vesicles (EVs) provided by EV donor cells, which are then injected into the patient, causing an immunogenic response to the desired pathogen [2].
S. aureus is a gram-positive bacteria commonly found on skin [3]. It becomes problematic when it enters the body through skin injuries, with infections occurring the most frequently in healthcare facilities due to wounds from surgeries or injections, where patients are also the most prone to severe symptoms [4]. Common symptoms of serious S. aureus infection include chest pain and coughs, fatigue, fever, headaches, rashes, and wounds that do not heal [3]. S. aureus has gained resistance to most common antibiotics by integrating various bacterial genes, after successive generations of selective pressure by antibiotic treatment. MRSA, which is just one strain of S. aureus that was identified in 1961, first evolved after widespread treatment with the antibiotic penicillin became common in the 1940’s [5]. S. aureus that had randomly integrated the blaZ gene for the beta-lactamase enzyme could survive treatment by enzymatically breaking down the beta-lactam ring in penicillin, and the resulting proliferation of this mutation rendered penicillin largely ineffective [6]. Then, when treatment with methicillin, a semisynthetic penicillinase-resistant beta-lactam antibiotic, became common, a strain of S. aureus integrated the mecA gene for the PBP2a transpeptidase that allowed resistance against all beta-lactam antibiotics [6]. While “Methicillin-resistant” is the most well known epithet of the strain, there are other major antibiotics that it has developed resistance to, as well as other strains of S. aureus that have developed resistance to other antibiotics including erythromycin, clindamycin, and fluoroquinolone [7]. Overall, the CDC estimates that MRSA is responsible for more than 70,000 severe infections and 9,000 deaths per year [8]. This wide range of resistance along with the severity of infection has created an urgency for the research and development of antibiotic techniques that are effective against MRSA.
To this end, S. aureus has various antigens that can be exploited for the production of a vaccine, including capsular polysaccharide 5 (CP5), capsular polysaccharide 8 (CP8), iron-regulated surface determinant B (IsdB), clumping factor A (ClfA), manganese transport protein C (MntC), staphylococcal enterotoxin B (SEB), ferric-hydroxamate uptake D2 (FhuD2), and alpha-hemolysin (Hla) [7].
Our team proposes a method to engineer Streptomyces coelicolor to overexpress S. aureus antigens that are fused to proteins that are commonly found on the membrane of extracellular vesicles, allowing the vesicles to be injected as a vaccine that is effective for humans against MRSA. S. coelicolor has a number of characteristics that make it an attractive cell chassis for this purpose, such as not eliciting an immune response in humans, being overall nonpathogenic and therefore easy to acquire, and possessing a fully sequenced genome [9].
Actinomycetes Secrete Extracellular Vesicles
It was previously believed that Streptomyces, a genus of Actinomycetes, primarily secrete metabolites into the surrounding substrate as free molecules unbound to any other molecule, and thus this was the primary method in which Streptomyces were used to produce desirable compounds. However, a review by Meyer and Nodwell suggested that Streptomyces also use EV’s, allowing for diverse antimicrobial packaging of compounds [10]. Their research was guided by three main questions: how common is extracellular vesicle packaging for antimicrobial metabolites, do the metabolites themselves facilitate the extracellular vesicle production, and lastly, how does vesicle encapsulation affect drug delivery? They found that antimicrobial metabolites with diverse structures and functions are created and encapsulated in vesicles [10]. Additionally, metabolite production and vesicle production are temporally linked [10]. Finally, through membrane fusion, extracellular vesicles can directly deliver metabolites to pathogens [10].
In the study, high molecular weight (MW) and low molecular weight fractions of supernatants collected from centrifugation of seventeen different strains of antimicrobial producing actinomycetes were compared [10]. FM 4-64 fluorescent lipid stain dye was added to each fraction, resulting in fluorescence in the high MW fractions, but not the low MW fractions, indicating the presence of EV’s [10]. There was also evidence of specialized metabolites in the high MW fractions, with nine fractions exhibiting antimicrobial activity [10]. Vesicles of different sizes were isolated through size exclusion chromatography purification, and cargo carried by the vesicles was extracted and further analyzed using LC-MS/MS (liquid chromatography-mass spectrometry) to confirm that expected metabolites were carried in the vesicles, thus showing that it is a widespread phenomenon for the bacteria to secrete antimicrobial specialized metabolites through the use of EV’s [10].
Although this research was based on the ability of streptomyces to deliver antimicrobials, the presence of specialized metabolites within produced EV’s provides credence to the viability of the main focus of this paper, namely, the inclusion of S. aureus antigens in EV’s produced by S. coelicolor.
Design Justification
Our experimental design will consist of a multi-step process to construct extracellularly-secreted vesicles, with S. aureus antigens presented on their surface, using S. coelicolor host cells.
The first step will be to identify the genes expressing the S. aureus antigens. These antigens will then be modified to form a nonpathogenic, or weakened, mutant. This reduces the capability of the antigens to trigger disease symptoms, while retaining a semblance of the original chemical form that the human immune system can then develop a response to. We will use two antigens in our design, but we will use two different colonies to express their respective vesicles in order to reduce metabolic burden. The vesicles would then be purified and joined together into one vaccine.
We will use staphylococcal enterotoxin B (SEB) as one antigen in our vaccine because this is the antigen responsible for causing septic shock in humans [11]. Thus, it is one of the most harmful antigens and it is critical to have immunity to it for a vaccine to be effective. We will also use Hla (hemolysin, aka ɑ-toxin) which destroys red blood cells. SEB will be modified (mSEB) to remove its ability to cause septic shock, and Hla will be modified (mHla) to remove its hemolytic effect. The Hla and SEB must be modified prior to incorporation into the S. coelicolor plasmid. This can be achieved while maintaining the antigens’ immunogenicity [11].
One consideration we have to account for is that we will need to cause the antigen to be presented by the EVs that are secreted by S. coelicolor. We will attach a surface protein, SCO2828, to the antigen that is coded for by our altered plasmid. SCO2828 is the substrate-binding protein component of an ATP binding transporter complex (ABC transporter), which is an integral membrane protein, and thus will be found on the substrate-facing side of the cell membrane. The fusion proteins with SCO2828 and either the Hla or SEB antigen will bind to ABC transporter complexes coded for in the genome of S. coelicolor. Membrane proteins found in the cell membranes of gram-positive bacteria, such as S. coelicolor, are commonly believed to be found in the membranes of membrane vesicles in gram-positive bacteria [9][12]. Thus by attaching our antigen to the SCO2828 protein, it should be presented by the membrane vesicles secreted by S. coelicolor. To cause this fusion, we will add a gene to our construct that codes for SCO2828 downstream of the antigen genes, so that antigen-SCO2828 fusion proteins will be produced. We will then see the fusion proteins from SCO2828 and its respective antigens (either mSEB or mHla) produced when the plasmid is expressed.
After the genes are amplified using PCR, digested, and ligated into one construct (Figure 2), the plasmid vectors will be altered with the modified antigen genes, SCO2828, and a selection marker for streptomycin resistance via restriction enzyme cleavage and subsequent ligation. S. coelicolor is susceptible to streptomycin, which is produced by Streptomyces griseus, unless it is mutated [13] so we would use a strain that is unmutated. This is for the later purpose of verification of transformation, since untransformed strains will be susceptible to streptomycin, while transformed strains will not be susceptible, allowing for easy identification of transformation through the application of streptomycin to plated cultures. The vesicles produced with the presented antigen-SCO2828 complex can then be purified and injected to initiate a human immune response. Since we are using two cultures of bacteria to produce two different antigen-SCO2828 complexes, the vesicles produced and purified will be combined into one vaccine for injection.
When considering the specific genetic construct, we have to take into consideration the promoter strength, the ribosome binding site, and the genes following those two sites. Our genetic construct will use the promoter SPL57 (synthetic promoter library 57) that was shown to double the production of toyocamycin in the strain S. diastatochromogenes 1628 when attached to the gene producing the ToyA regulator [14]. This was demonstrated in previous studies through comparison to wild-type strains [14]. This is due to the ToyA regulator activating the ToyB and ToyE operons [15][16]. This synthetic promoter already has a preexisting ribosome binding site within its sequence. The use of this promoter will cause overexpression of both mSEB or mHla and SCO2828 since it is a strong promoter. We will insert the genes for the antigen-SCO2828 fusion proteins, as well as the gene for the streptomycin resistance selection marker, following the insertion of two SPL57 promoters into the plasmid PTU-A-000. This will allow for the production of all of our necessary vaccine components, as well as a method of verification of vesicle production. We will create two different cultures, producing mSEB-SCO2828 and mHla-SCO2828 respectively, to help reduce the metabolic burden on the cell chassis. Then, the purified vesicles with these antigens will be combined together to form one vaccine with both antigens.
Experimental Design
We will insert the SPL57 promoter, an antigen gene, SCO2828 gene, and the rsp14 gene (for streptomycin resistance) into the synthetic plasmid PTU-A-000 via PCR, restriction, and ligation. There will be two differently edited plasmids, one will code for the mHla antigen, and the other will code for the mSEB antigen. First, the Hla and SEB genes will be purchased. Once we have these genes, the Hla will be mutated to change the 35th amino acid from a histidine to a leucine, while the SEB will be mutated to change 3 amino acids: change the leucine at position 45 to an arginine, the tyrosine at position 89 to an alanine, and the tyrosine at position 94 to an alanine [11]. These mutations will be done following the procedure in Zeng et. al. [11].
The genes will be conjugated with the antigens upstream of the SCO2828 before the multi-gene complex is inserted into the plasmid. The multigene complex will be produced by ligating the SPL57 promoter to the antigen, then ligating SCO2828 to the SPL57-antigen complex, then ligating another SPL57 to the SPL57-antigen-SCO2828 complex, and finally adding rsp14. This is achieved by multiple rounds of PCR, digestion, and ligation.
Since our primary method for building the gene is PCR, digestion, and ligation, we need to ensure that compatible restriction enzyme sites allow for the target genes' ligation. To determine the location of the digestion and ligation, we first evaluated the structure of the PTU-A-000 (pTU) plasmid and determined that the plasmid is capable of producing ampicillin antibiotics. Since ampicillin antibiotic production is irrelevant to future steps, we chose a digestion site inside the coding region for AmpR. By doing so, we are eliminating any unnecessary production of ampicillin resistance and reducing the potential metabolic burden of the plasmid. In addition, we need to use a single cut restriction enzyme (RE) site so that digestion does not occur anywhere else on the plasmid. Similar to the plasmid, the RE sites on the inserted genes must not be identical to those used on the genes they are ligated to, as there is a chance the RE site ligates to itself instead of the target gene.
Ligation and Primer Design
Using the Hpy188I RE site at the beginning of SPL57, we can use the BsaI RE site which occurs once within the plasmid and is located at 2751bp. To ensure the site's compatibility, we added an overhang of TGGC in the forward primer of SPL57. The digest of the plasmid is from BsaI to AseI (position of 2862bp), meaning that we are removing 111bp during the digestion of pTU. Now that we have determined the digestion site on pTU and how SPL57 will bind to it, we need to assemble the rest of the linear genetic construct before conducting ligation in the plasmid. We will use the MspJI RE site at the end of the SPL57 and a SgeI RE site at the beginning of mSEB to make the ligation. A C overhang will be added on the forward mSEB primer to ensure compatibility. To ligate mSEB to SCO2828, we can use a MboII RE site at the end of mSEB and a AciI RE site at the beginning of SCO2828. To ligate SCO2828 to SPL57, we use the AbaSI RE site at the end of the SCO2828 and the Hpy188I RE site at the SPL57 with an added overhang of CGG to the forward primer. To ligate the SPL57 to the rsp14 (Streptomycin resistance gene), we use the LpnPI RE site on the end of the SPL57 and a Tru9I RE site (position 19bp) at the beginning of rsp14 with an added ACCA overhang to ensure compatibility. The rsp14 gene will then bind to the AseI site located on the pTU plasmid. This is done by using the Alw26I RE site located at the end of the rsp14 with a GTA overhang located on the TatI RE site. All of the primers have leader sequences since we want restriction enzyme sites on both sides of our PCR product.
For the mHla plasmid, the only differences in the genetic construct are the ligation of SPL57 to mHla and mHla to SCO2828. For ligation from SPL57 to mHla, we will use the MspJI RE site of SPL57 to the FspEI RE site with added C overhang on the forward mHla primer. Using the ClaI RE site on mHla and AciI RE site on SCO2828 with a CG overhang on the forward SCO2828 primer. For future gel electrophoresis to ensure the uptake of the genes, we determined that the length of the recombinant mSEB plasmid is 12350bp in length and the mHla plasmid is 12509bp in length. The specific primer sequences can be found in Table S1 at the end of this paper.
Polymerase Chain Reaction (PCR) Procedure
Each round will consist of the same steps, using different primers and DNA each time. Before digestion, the original DNA will be amplified using standard PCR techniques. The designed primers will add the necessary restriction sites to our gene sequences. We will focus on how to do the steps following PCR here. For the first step, digestion, we will add 1μg of the target DNA, 3 uL of each restriction enzyme, 3 uL of the buffer, and dH2O to a total 30 uL to a 1.5 mL tube. We will mix it, then allow it to incubate at 37 C for at least 4 hours. During this time, the enzymes will cut at the restriction sites. The digested DNA can be isolated via agarose gel purification. Next, to ligate, we will add about 100 ng total DNA (3 times as much vector as insert by mole), 1-2 uL ligase buffer depending on the type, 0.5-1 uL T4 DNA Ligase, dH2O to total 10 uL to a PCR tube. Incubation then happens at conditions that vary between ligation buffers [17].
As can be seen in the primer designs, once amplified, the gene sequences will be cut at their restriction sites in order to be ligated to whichever sequence it is reacting with at that time. This means we will have 5 rounds of PCR, digestion and ligation. We need the SPL57 to ligate to the gene for mSEB or mHla depending on which construct it is, then we will have the gene for mSEB ligate to the gene for SCO2828. After that we will have the gene for SCO2828 ligate to another SPL57 promoter and then have the SPL57 promoter ligate to the gene for streptomycin resistance. Finally, we will cleave and ligate the genetic construct on either ends, where the beginning of the first SPL promoter is and where the end of the streptomycin resistance gene is, into the plasmid PTU-A-000.
After we genetically alter the plasmid to include the required genes, we will run a gel electrophoresis to see if the plasmids are the expected altered lengths. Running a gel electrophoresis allows us to see whether the plasmid is the expected altered length of 12509bp (mHla) and 12350bp (mSEB). We will also run an untransformed plasmid of expected length 3546bp as a control. After running these against a ladder, if the supposedly transformed plasmid is the expected length then that plasmid has been successfully transformed. We will keep most of the plasmids and only test a small concentration in this step.
Once the expected lengths are confirmed, we will heat shock the plasmid into competent S. coelicolor that have not mutated to have streptomycin resistance. This is done by thawing the competent cells from the -80℃ freezer using ice for about 30 minutes. We will add about 10 ng of the transformed plasmid into the tubes with the competent bacterial cells. We put the tube into a water bath that’s at 42℃ for 30-60 seconds and then back on ice for two minutes. We will add about 500µL of tryptic soy broth (TSB) media without streptomycin to this mixture [18]. Doing this allows for the antibiotic resistance encoded by the genetically altered plasmid to develop. We will plate this mixture of cells and media on an agar plate with streptomycin and then incubate overnight at 37℃ [19]. The colonies that are able to grow indicate successful transformation. We will do this process twice, once for the SEB-SCO2828 plasmid and once for the Hla-SCO2828 plasmid. We will then have two experimental plates of bacteria to be cultured. We will also have a plate for a negative control which is colonies of S. coelicolor that have not been transformed to have the altered plasmids plated on the agar plates with streptomycin. These plates should show no colony growth because they are not resistant to streptomycin. We will also plate a positive control which is untransformed S. coelicolor plated on media without streptomycin. These bacteria should grow as expected without the antibiotic present.
In order to test for vesicle secretion, we will centrifuge colonies suspended in a buffer solution to obtain high MW supernatant fractions, as described in Meyer and Nodwell [10]. We will use a fluorescence dye, FM4-64, that binds to membrane lipids and spreads throughout the lipid bilayer to confirm the presence of EV’s. First, we will incubate the culture samples with the dye for an hour. We will then run the culture through additional centrifugation at 5000 xg for 5 minutes to wash out unnecessary fluorescence and isolate the stained vesicles. We will use confocal microscopy at around 515 nm and a spectrophotometer in order to detect the fluorescence and the red color of the dye on the sample. The increased fluorescence and imaging will ensure the existence of lipids in the high MW supernatant fractions, and thus vesicles, in the cultures.
To test for the expression of our genetic construct we will use western blotting. Since our vesicles are already isolated with centrifugation, we will move on to lysing them using a bacterial lysis buffer in hopes of exposing the antigens. We will use gel electrophoresis to separate the sample's proteins and have antibodies (Anti-Hla and Anti-SEB) detect our target antigens. We will have two rounds of incubation with the antibodies. The round of second antibodies will be conjugated with a fluorescence dye (GFP fluorescence) [20]. It will be run through confocal microscopy to detect any binding. The antibodies binded will confirm the antigens are presented by the vesicles.
Conclusion
The focus of this paper was the development of a novel extracellular-vesicle delivered vaccine against S. aureus, to be manufactured using the transformation of a S. coelicolor cell chassis. By genetically engineering the EV’s of S. coelicolor to present staphylococcal enterotoxin B (SEB), and hemolysin (Hla) fusion proteins with reduced pathogenicity on their surface, a theoretical vesicle vaccine was presented. Two separate cultures of SCO2828-mSEB producing, and SCO-2828-mHla producing S. coelicolor will be plated, and subsequent extracellular vesicles isolated will be mixed together in a final vaccine. Gel electrophoresis will be used to test if the mutated plasmid is of the expected length before it is transformed into S. coelicolor, FM4-64 lipid stain will be used to test for the presence of extracellular vesicles in the cultures, and western blotting and affinity chromatography will be used to test for the presence of the antigen fusion proteins in the vesicle fractions derived from centrifugation. Once the EV’s are isolated, the vaccine will be able to enter the in vivo stage of testing for effectiveness.
About the Author: Jordan Chen
Jordan is a class of 2025 Biochemical Engineering major with a passion for all fields of STEM, as well as design. He had been with The Aggie Transcript for four years since Fall quarter of his Freshman year, and as Head of Design for three years, helped put together the journal’s annual print edition. Outside of academics, Jordan enjoys music and art.
Author's Note
This paper was written for the class BIM161A (Biomolecular Engineering) as part of the final project. The project centered around researching and constructing an experimental procedure that could be used to produce extracellular vesicle vaccines against Staphylococcus aureus in a cell chassis of our choice. Our group chose the cell chassis of Streptomyces coelicolor and collectively wrote this paper.
Supporting Information
SPL57 |
5’ - ATATATTGGCATGGAACGGCTGGAGGGATAC - 3’ (Fwd) 5’ - ATATATTGGTATCCTATGACCAGGT- 3’ (Rev) |
| SEB |
5’ - atatatcatgtataagagattatttatttcacatgtaattttgatattcg - 3’ (Fwd) 5’ - atatatttgattctaaagatgtgaagattgaagtttatcttacgacaa - 3’ (Rev) |
| Hla |
5’ - ATATATCATGAAAACACGTATAGTCAGCTCAGTAAC - 3’ (Fwd) 5’ - ATATATTTAATTTGTCATTTCTTCTTTTTCCCAATCG - 3’ (Rev) |
| SCO2828 |
5’ - atatattatggcgccgccg - 3’ (Fwd) (SEB) 5’ - atatatcgatggcgccgccg - 3’ (Fwd) (Hla) 5’ - atatatcgggccgccgcacagttctt - 3’ (Rev) |
| RSP14 |
5’ - ATATATACCAATGTAATGATGATCGAAATAAGGTCTGAAAT - 3’ (Fwd) 5’ - ATATATCTCTCTTTCCGGTGTGGA - 3’ (Rev) |
| Leader Sequence (Used on all primers) |
| 5’ - ATATAT - 3’ |
References
- Aslam, B., Wang, W., Arshad, M. I., Khurshid, M., Muzammil, S., Rasool, M. H., Nisar, M. A., Alvi, R. F., Aslam, M. A., Qamar, M. U., Salamat, M. K. F., & Baloch, Z. (2018). Antibiotic resistance: a rundown of a global crisis. Infection and drug resistance, 11, 1645–1658. https://doi.org/10.2147/IDR.S173867
- Sabanovic B, Piva F, Cecati M, Giulietti M. Promising Extracellular Vesicle-Based Vaccines against Viruses, Including SARS-CoV-2. Biology (Basel). 2021 Jan 27;10(2):94. doi: 10.3390/biology10020094. PMID: 33513850; PMCID: PMC7912280.
- MRSA Infections (methicillin-resistant staphylococcus aureus). (2022, July 1). PennMedicine. https://www.pennmedicine.org/for-patients-and-visitors/patient-information/conditions-treated-a-to-z/mrsa-methicillin-resistant-staphylococcus-aureus
- Laboratory Testing. (2019, February 6). Centers for Disease Control and Prevention. https://www.cdc.gov/mrsa/lab/index.html
- Lee, A., de Lencastre, H., Garau, J. et al. Methicillin-resistant Staphylococcus aureus. Nat Rev Dis Primers 4, 18033 (2018). https://doi.org/10.1038/nrdp.2018.33
- Vestergaard, M., Frees, D., Ingmer, H. (2019, March 22). Antibiotic Resistance and the MRSA Problem. Microbiology Spectrum, 7(2). https://doi.org/https://doi.org/10.1128/microbiolspec.gpp3-0057-2018
- Infection Control Guidance: Preventing Methicillin-resistant Staphylococcus aureus (MRSA) in Healthcare Facilities. n.d. CDC. https://www.cdc.gov/mrsa/hcp/infection-control/index.html
- Jahantigh, H. R., Faezi, S., Habibi, M., Mahdavi, M., Stufano, A., Lovreglio, P., & Ahmadi, K. (2022). The Candidate Antigens to Achieving an Effective Vaccine against Staphylococcus aureus. Vaccines, 10(2), 199. https://doi.org/10.3390/vaccines10020199
- Chater, K.F., “Streptomyces,” Brenner’s Encyclopedia of Genetics (Second Edition), 2019.
- Meyer, K. J., & Nodwell, J. R. (2023, January 1). Streptomyces extracellular vesicles are a broad and permissive antimicrobial packaging and delivery system. bioRxiv. https://www.biorxiv.org/content/10.1101/2023.10.02.560488v1
- Zeng, H., Yang, F., Feng, Q., Zhang, J., Gu, J., Jing, H., Cai, C., Xu, L., Yang, X., Xia, X., Zeng, N., Fan, S., & Zou, Q. (2020). Rapid and broad immune efficacy of a recombinant five-antigen vaccine against Staphylococcus aureus infection in animal models. Vaccines, 8(1), 134. https://doi.org/10.3390/vaccines8010134
- Kim, Y., Edwards, N., & Fenselau, C. (2016). Extracellular vesicle proteomes reflect developmental phases of Bacillus subtilis. Clinical proteomics, 13, 6. https://doi.org/10.1186/s12014-016-9107-z
- Westhoff, S., Otto, S. B., Swinkels, A., Bode, B., van Wezel, G. P., & Rozen, D. E. (2020). Spatial structure increases the benefits of antibiotic production in Streptomyces. Evolution; international journal of organic evolution, 74(1), 179–187. https://doi.org/10.1111/evo.13817
- Sohoni, S. V., Fazio, A., Workman, C. T., Mijakovic, I., & Lantz, A. E. (2014). Synthetic promoter library for modulation of actinorhodin production in Streptomyces coelicolor A3(2). PloS one, 9(6), e99701. https://doi.org/10.1371/journal.pone.0099701
- Zhou, Q., Ning, S., & Luo, Y. (2020). Coordinated regulation for nature products discovery and overproduction in Streptomyces. Synthetic and systems biotechnology, 5(2), 49–58. https://doi.org/10.1016/j.synbio.2020.04.002
- Xu, J., Song, Z., Xu, X., Ma, Z., Bechtold, A., Yu, X. (2019, June 29). ToyA, a positive pathway-specific regulator for toyocamycin biosynthesis in Streptomyces diastatochromogenes 1628. Applied Microbiology and Biotechnology, 103, 7071-7084. https://doi.org/https://doi.org/10.1007/s00253-019-09959-w
- Plasmid Cloning by Restriction Enzyme Digest (aka Subcloning). (n.d.). Addgene. https://www.addgene.org/protocols/subcloning/
- Shepherd, M. D., Kharel, M. K., Bosserman, M. A., & Rohr, J. (2010). Laboratory maintenance of Streptomyces species. Current protocols in microbiology, Chapter 10, Unit–10E.1. https://doi.org/10.1002/9780471729259.mc10e01s18
- Bacterial Transformation. (n.d.). Addgene. https://www.addgene.org/protocols/bacterial-transformation/
- Hu, K., McKay, P. F., Samnuan, K., Najer, A., Blakney, A. K., Che, J., … Shattock, R. J. (2022). Presentation of antigen on extracellular vesicles using transmembrane domains from viral glycoproteins for enhanced immunogenicity. Retrieved from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8888812/
- Lorenz T. C. (2012). Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies. Journal of visualized experiments : JoVE, (63), e3998. https://doi.org/10.3791/3998
- DNA Ligation. (n.d.). Addgene. https://www.addgene.org/protocols/dna-ligation/
- Restriction Digest of Plasmid DNA. (n.d.). Addgene. https://www.addgene.org/protocols/restriction-digest/